Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20034)
Regulator Name hsa-miR-30e-5p (miRNA)
Synonyms
hsa-miR-30e-5p
    Click to Show/Hide
Gene Name hsa-miR-30e-5p
Regulator Type miRNA
MiRBase ID MIMAT0000692
Sequence
UGUAAACAUCCUUGACUGGAAG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-30e-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Endotheliitis ICD-11: 1F00
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
AMPK signaling pathway hsa04152
Cell Process Cell ferroptosis
In Vitro Model
 hEPCs (Endothelial progenitor cells)
HUVECs (Human umbilical vein endothelial cells)
Response regulation EPCs-Exos inhibited Erastin-induced HUVEC ferroptosis and endothelial injury. EPCs-Exos promoted the activation of the AMPK pathway by upregulating the expression of miR-30e-5p in HUVECs and inhibiting the expression of SP1 in HUVECs, thus inhibiting Erastin-induced cell ferroptosis.
Endotheliitis [ICD-11: 1F00]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-30e-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
AMPK signaling pathway hsa04152
Cell Process Cell ferroptosis
In Vitro Model
 hEPCs (Endothelial progenitor cells)
HUVECs (Human umbilical vein endothelial cells)
Response regulation EPCs-Exos inhibited Erastin-induced HUVEC ferroptosis and endothelial injury. EPCs-Exos promoted the activation of the AMPK pathway by upregulating the expression of miR-30e-5p in HUVECs and inhibiting the expression of SP1 in HUVECs, thus inhibiting Erastin-induced cell ferroptosis.
References
Ref 1 Endothelial progenitor cells-derived exosomes transfer microRNA-30e-5p to regulate Erastin-induced ferroptosis in human umbilical vein endothelial cells via the specificity protein 1/adenosine monophosphate-activated protein kinase axis. Bioengineered. 2022 Feb;13(2):3566-3580. doi: 10.1080/21655979.2022.2025519.