Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20026)
Regulator Name hsa-miR-142-3p (miRNA)
Synonyms
hsa-miR-142-3p
    Click to Show/Hide
Gene Name hsa-miR-142-3p
Regulator Type miRNA
MiRBase ID MIMAT0000434
Sequence
UGUAGUGUUUCCUACUUUAUGGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-142-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
4F2 cell-surface antigen heavy chain (SLC3A2) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
 Hep-G2 cells Hepatoblastoma Homo sapiens CVCL_0027
THP-1 cells Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Response regulation MiR-142-3p promoted HBV-infected M1-type macrophage ferroptosis through SLC3A2, affecting the production of GSH, MDA, and Fe2+and accelerating the development of hepatocellular carcinoma (HCC). Inhibition of miR-142-3p or overexpression of SLC3A2 reversed ferroptosis and inhibited the proliferation, migration, and invasion of HCC cells.
Hepatocellular carcinoma [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-142-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
 Hep-G2 cells Hepatoblastoma Homo sapiens CVCL_0027
THP-1 cells Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Response regulation MiR-142-3p promoted HBV-infected M1-type macrophage ferroptosis through SLC3A2, affecting the production of GSH, MDA, and Fe2+and accelerating the development of hepatocellular carcinoma (HCC). Inhibition of miR-142-3p or overexpression of SLC3A2 reversed ferroptosis and inhibited the proliferation, migration, and invasion of HCC cells.
References
Ref 1 Exosomal miR-142-3p secreted by hepatitis B virus (HBV)-hepatocellular carcinoma (HCC) cells promotes ferroptosis of M1-type macrophages through SLC3A2 and the mechanism of HCC progression. J Gastrointest Oncol. 2022 Apr;13(2):754-767. doi: 10.21037/jgo-21-916.